Q1. You are a member of a drug discovery team and tasked with identifying three potential targets for novel antibiotics. As you learned in BCH311, an ideal antibiotic will target prokaryotes but not eukaryotes. Therefore, your team wants to engineer novel antibiotics that target prokaryotic information transfer (nucleotide biosynthesis, replication, transcription or translation) that will not affect humans. Your role on the team is the following:
Identify three differences between prokaryotes and eukaryotes regarding information transfer that could serve as a druggable targets. Present this information to your team by designing a graphical abstract (1-page max) that illustrates these three differences. Include the three theoretical drugs in your figure, one for each of the differences you have highlighted, and clearly show where it would target. (6 marks)
Provide a figure caption to accompany your figure (350 words max) that explains the differences and highlights how your theoretical drugs would work. (4 marks)
Tips for success
You may use images/figures from the course material (encouraged), but you may modify these images (also encouraged) to highlight your message (i.e. crop, add labels, change colours, etc.). You do not need to reference any material you are using from the course.
You may use images from additional sources if you find this helpful, but this is not required. If you do, please do reference this material by stating “adapted from Author, Year” in your caption with a full reference list at the bottom (references would not count towards your word limit).
Focus on images. You want to make a visual impact. Avoid large pieces of text in the graphical abstract.
You do not need to find a drug already in use, or draw a theoretical drug structure, you can use a simple cartoon schematic or inhibitor symbol in your graphical abstract.
You do not need to include a component from each area of information transfer, (replication, transcription, translation) but you do want to propose three separate differences and potential inhibition mechanisms.
Ensure your graphical abstract is clear, cohesive and easy to follow – consider using colour-coding, labels and symbols (examples below).
Q2. You are a cancer researcher studying estrogen receptor signaling in human breast cancer. You have identified a patient with a point mutation in gene the encoding the estrogen receptor (ESR1). The point mutation prevents transcription termination, leading to a reduction in overall estrogen receptor expression levels. Part of the human ESR1 gene is shown below (coding strand). Your goal is to correct this point mutation using CRISPR-cas9.
5’-ttgtgattagagtcattgaatagctagactgactaatgtctgtcaacaccgaagcatcgtaagaaagtcatgtgttctactgtgtgtgtgtgtagcact-3’
Propose a 20nt crRNA (sgRNA) to target a Cas9 double-stranded break within this gene. Remember to write the sequence 5’ to 3’. (3 marks)
Specify the sequence of your repair template (assume a 30bp template is enough). Only necessary to show the top strand of your repair template and remember to write the sequence 5’ to 3’. (3 marks)
Indicate with arrows where the HNH and RuvC domains would cleave the DNA and put a box around the PAM. You can add these onto the sequence given in the question. (3 marks)
Name a technique you would use to confirm that you have successfully corrected the point mutation in the ESR1 gene. (Name of the technique only – max 5 words). (1 mark)
Q3. You have just identified a novel protein involved in information transfer, which you have decided to name IWillRockBCH311 (IWRB). Before celebrating your Nobel Prize, you must characterize the protein.
You perform a DNA foot printing experiment using IWRB and obtain the following results. Describe the data and state what you can conclude from the resulting gel (75 words). (2 marks)
You hypothesize that IWRB is involved in bringing together distal chromatin elements to regulate DNA replication.
Design an experiment to address this hypothesis (250 words). (4 marks)
How would you demonstrate that IWRB binding of distal chromatin elements impacts DNA replication (250 words)? (4 marks)
